uaagauaucagaggaaaguccucugaucaaacaugcgcuuccaauaguagaaggacguuaagcauuuaucauugaacuag
uucauugaagucauugaugcaaacuccuuggucacacacggcgcggaaggcguguuugcugacguuccauucccuuguuu
caaucauugguuaacugauuuuuggggcccuuuguuucuucugccuggagaaguuugacaccaaauauugguguuagggg
agcuggggccuuucaaaauuuuggaaggucuugguaggaacggguggaucuuauaauuuuugauuuau
The query sequence (length=308) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6n7x:R | 308 | 308 | 1.0000 | 1.0000 | 1.0000 | 2.40e-163 | |
2 | 8w2o:R | 327 | 324 | 0.9968 | 0.9388 | 0.9475 | 6.92e-139 | |
3 | 5zwn:P | 480 | 281 | 0.8377 | 0.5375 | 0.9181 | 2.61e-103 | |
4 | 5zwn:P | 480 | 53 | 0.1721 | 0.1104 | 1.0000 | 1.36e-21 | |
5 | 6g90:1 | 327 | 248 | 0.7110 | 0.6697 | 0.8831 | 7.58e-74 | |
6 | 6n7r:R | 558 | 187 | 0.5649 | 0.3118 | 0.9305 | 1.64e-70 | |
7 | 6n7r:R | 558 | 95 | 0.2922 | 0.1613 | 0.9474 | 6.20e-35 | |
8 | 6n7r:R | 558 | 54 | 0.1753 | 0.0968 | 1.0000 | 3.79e-22 | |
9 | 6n7p:R | 558 | 187 | 0.5617 | 0.3100 | 0.9251 | 7.64e-69 | 7oqc:1, 7oqe:1 |
10 | 6n7p:R | 558 | 95 | 0.2922 | 0.1613 | 0.9474 | 6.20e-35 | 7oqc:1, 7oqe:1 |
11 | 6n7p:R | 558 | 54 | 0.1753 | 0.0968 | 1.0000 | 3.79e-22 | 7oqc:1, 7oqe:1 |