BioLiP

>rna
guuucucuucagaucgcauaaaucuuucgccuuuuacuaaagauuuccguggagaggaacaaccaauuuuuugag

The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	6qdv:5	75	75	1.0000	1.0000	1.0000	1.57e-34
2	7w59:B	84	76	1.0000	0.8929	0.9868	7.31e-33	7w5a:B, 7w5b:B, 5xjc:B, 5yzg:B, 5z56:B, 5z57:B, 5z58:B
3	7dvq:B	90	76	1.0000	0.8333	0.9868	7.31e-33
4	9fmd:5	92	75	0.9867	0.8043	0.9867	2.63e-32	8ro2:5
5	8i0p:B	98	77	1.0000	0.7653	0.9740	9.46e-32	8i0r:B, 8i0s:B, 8i0t:B, 8i0u:B, 8i0v:B, 8i0w:B
6	8ch6:e	98	78	0.9867	0.7551	0.9487	2.05e-28	7qtt:e
7	6zym:5	74	63	0.8400	0.8514	1.0000	7.36e-28
8	8r09:5	112	63	0.8400	0.5625	1.0000	7.36e-28	8r0b:5, 8rm5:5
9	8qzs:5	109	63	0.8400	0.5780	1.0000	7.36e-28	8y6o:B
10	8qpk:5	77	63	0.8400	0.8182	1.0000	7.36e-28
11	8qoz:5	79	63	0.8400	0.7975	1.0000	7.36e-28	8qpa:5, 8qpb:5
12	6id0:B	98	63	0.8400	0.6429	1.0000	7.36e-28	6id1:B
13	6icz:B	97	63	0.8400	0.6495	1.0000	7.36e-28
14	8h6e:5A	114	63	0.8400	0.5526	1.0000	7.36e-28	8h6j:5A
15	6ff4:5	70	63	0.8400	0.9000	1.0000	7.36e-28	6ff7:5
16	8c6j:5	113	63	0.8400	0.5575	1.0000	7.36e-28
17	6ah0:B	115	63	0.8400	0.5478	1.0000	7.36e-28	6ahd:B, 8h6k:5A, 8h6l:5A, 8q7n:5, 8qo9:5, 8qpe:5, 8r0a:5
18	7abg:5	114	63	0.8400	0.5526	1.0000	7.36e-28	7abi:5, 5mqf:5, 5o9z:5
19	7aav:5	69	63	0.8400	0.9130	1.0000	7.36e-28
20	7abf:5	58	58	0.7733	1.0000	1.0000	4.43e-25
21	8qp8:5	71	63	0.7733	0.8169	0.9206	7.47e-18	8qp9:5
22	8q7q:5	104	63	0.7733	0.5577	0.9206	7.47e-18	8q7v:5, 8q7w:5, 8q7x:5, 8q91:5, 6qw6:5, 6qx9:5, 8qxd:5, 8r08:5, 8rc0:5
23	8ro1:5	111	39	0.4933	0.3333	0.9487	3.50e-11
24	8ro0:5	111	39	0.4933	0.3333	0.9487	3.50e-11

[Back]