guucucuucacugugggaugagguaguagguuguauaguuuuccaccacugggagauaacuauacaaucuacugucuuuc
cuaacgugauagaaaa
The query sequence (length=96) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 9asp:E | 96 | 96 | 1.0000 | 1.0000 | 1.0000 | 4.58e-46 | |
| 2 | 5zal:C | 58 | 60 | 0.5521 | 0.9138 | 0.8833 | 1.03e-12 |
umich.edu