guucgcgaaguaacccuucguggacauuuggucaauuugaaacaauacagagaugaucagcaguuccccugcauaaggau
gaaccguuuuacaaagagauuua
The query sequence (length=103) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7dco:F | 103 | 103 | 1.0000 | 1.0000 | 1.0000 | 6.42e-50 | 5gm6:E, 5gmk:E, 6j6g:E, 6j6h:E, 6j6n:E, 6j6q:E, 5wsg:E, 5ylz:D |
2 | 7b9v:6 | 102 | 102 | 0.9903 | 1.0000 | 1.0000 | 2.31e-49 | 6bk8:6, 6exn:6, 5lqw:6 |
3 | 5y88:D | 101 | 101 | 0.9806 | 1.0000 | 1.0000 | 8.30e-49 | |
4 | 5mps:6 | 99 | 88 | 0.8544 | 0.8889 | 1.0000 | 1.40e-41 | 5mq0:6 |
5 | 5lj3:V | 97 | 87 | 0.8447 | 0.8969 | 1.0000 | 5.03e-41 | 5lj5:V |
6 | 5tf6:B | 71 | 70 | 0.6796 | 0.9859 | 1.0000 | 1.42e-31 | |
7 | 5nrl:6 | 95 | 87 | 0.7864 | 0.8526 | 0.9310 | 2.37e-29 | |
8 | 5vsu:I | 73 | 69 | 0.6505 | 0.9178 | 0.9710 | 3.97e-27 | |
9 | 5zwm:F | 99 | 102 | 0.8641 | 0.8990 | 0.8725 | 1.85e-25 | 5zwo:F |
10 | 6aso:I | 70 | 70 | 0.6408 | 0.9429 | 0.9429 | 2.39e-24 | |
11 | 5gan:W | 80 | 73 | 0.6408 | 0.8250 | 0.9041 | 2.41e-19 | |
12 | 4n0t:B | 65 | 70 | 0.6117 | 0.9692 | 0.9000 | 3.11e-18 | |
13 | 5gap:W | 56 | 63 | 0.5437 | 1.0000 | 0.8889 | 8.72e-14 | |
14 | 5tf6:D | 52 | 34 | 0.3301 | 0.6538 | 1.0000 | 1.46e-11 | |
15 | 3jcm:D | 45 | 48 | 0.4272 | 0.9778 | 0.9167 | 1.46e-11 |