guucgcgaaauuuuacuucguggacauuuggucaauuugaaacaauacagaaucagcaguuccccugcauaaggaugaac
cgucaaagagauuuguuuu
The query sequence (length=99) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5zwm:F | 99 | 99 | 1.0000 | 1.0000 | 1.0000 | 1.02e-47 | 5zwo:F |
2 | 5nrl:6 | 95 | 87 | 0.8586 | 0.8947 | 0.9770 | 3.73e-37 | |
3 | 5mps:6 | 99 | 87 | 0.7980 | 0.7980 | 0.9080 | 1.76e-25 | 5mq0:6 |
4 | 5lj3:V | 97 | 87 | 0.7980 | 0.8144 | 0.9080 | 1.76e-25 | 5lj5:V |
5 | 7dco:F | 103 | 102 | 0.8990 | 0.8641 | 0.8725 | 1.76e-25 | 5gm6:E, 5gmk:E, 6j6g:E, 6j6h:E, 6j6n:E, 6j6q:E, 5wsg:E, 5ylz:D |
6 | 7b9v:6 | 102 | 102 | 0.8990 | 0.8725 | 0.8725 | 1.76e-25 | 6bk8:6, 6exn:6, 5lqw:6 |
7 | 5y88:D | 101 | 87 | 0.7879 | 0.7723 | 0.8966 | 6.33e-25 | |
8 | 5gan:W | 80 | 70 | 0.6566 | 0.8125 | 0.9286 | 1.37e-21 | |
9 | 5tf6:B | 71 | 58 | 0.5455 | 0.7606 | 0.9310 | 3.84e-17 | |
10 | 5gap:W | 56 | 59 | 0.5455 | 0.9643 | 0.9153 | 1.79e-15 | |
11 | 3jcm:D | 45 | 41 | 0.4040 | 0.8889 | 0.9756 | 2.99e-13 |