BioLiP

>rna
gugcucgcuucggcagcacauauacuaaaauuggaacgauacagagaagauuagcauggccccugcgcaaggaugacauu
cgugaagcgu

The query sequence (length=90) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5o9z:6	90	90	1.0000	1.0000	1.0000	9.14e-43
2	6ahd:F	94	90	1.0000	0.9574	1.0000	9.14e-43	8qo9:6
3	5z56:F	93	92	1.0000	0.9677	0.9783	5.50e-40	5z57:F, 5z58:F
4	8ch6:d	93	92	0.9889	0.9570	0.9674	2.56e-38	7qtt:d
5	6zym:6	79	78	0.8667	0.9873	1.0000	4.28e-36
6	8q7n:6	78	78	0.8667	1.0000	1.0000	4.28e-36
7	6ff4:6	95	78	0.8667	0.8211	1.0000	4.28e-36	6ff7:6, 8i0p:F
8	8c6j:6	97	78	0.8667	0.8041	1.0000	4.28e-36	9fmd:6, 8i0r:F, 8i0s:F, 8i0t:F, 8i0u:F, 8i0v:F, 8i0w:F, 6icz:F, 6id0:F, 6id1:F, 6qdv:6, 8ro2:6, 7w59:F, 7w5a:F, 7w5b:F, 5xjc:F, 5yzg:F
9	7abi:6	91	93	0.9667	0.9560	0.9355	9.27e-33
10	7aav:6	73	75	0.8111	1.0000	0.9733	1.55e-30
11	8r09:6	65	60	0.6667	0.9231	1.0000	4.34e-26	8r0b:6
12	8rm5:6	64	59	0.6556	0.9219	1.0000	1.56e-25
13	8ro1:6	101	71	0.7444	0.6634	0.9437	5.62e-25
14	8ro0:6	90	71	0.7444	0.7444	0.9437	5.62e-25
15	8h6k:6A	60	56	0.6222	0.9333	1.0000	7.27e-24
16	8h6e:6A	59	55	0.6111	0.9322	1.0000	2.61e-23	8h6l:6A, 8qzs:6
17	5mqf:6	89	78	0.7889	0.7978	0.9103	3.38e-22
18	8qoz:6	48	48	0.5333	1.0000	1.0000	2.04e-19	8qpb:6
19	8qpa:6	47	47	0.5222	1.0000	1.0000	7.32e-19
20	7abg:6	78	89	0.8556	0.9872	0.8652	7.32e-19
21	7abf:6	65	46	0.5111	0.7077	1.0000	2.63e-18
22	3jb9:N	90	51	0.5444	0.5444	0.9608	9.47e-18
23	8r0a:6	59	51	0.5444	0.8305	0.9608	3.41e-17
24	8h6j:6A	54	47	0.5111	0.8519	0.9787	3.41e-17
25	8qpe:6	43	43	0.4778	1.0000	1.0000	1.22e-16
26	6qx9:6	53	46	0.4889	0.8302	0.9565	2.05e-14	8qxd:6, 8r08:6
27	6ah0:F	69	49	0.5111	0.6667	0.9388	2.05e-14
28	8qpk:6	43	38	0.4222	0.8837	1.0000	7.37e-14
29	6qw6:6	42	37	0.4000	0.8571	0.9730	1.23e-11
30	8qp8:6	37	34	0.3667	0.8919	0.9706	5.74e-10	8qp9:6

[Back]