gugaugcuucgcguggagaaugacguagcaugcuacg
The query sequence (length=37) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7uoe:T | 37 | 37 | 1.0000 | 1.0000 | 1.0000 | 7.11e-14 | |
2 | 7uob:T | 36 | 34 | 0.9189 | 0.9444 | 1.0000 | 3.31e-12 | |
3 | 7uob:P | 33 | 33 | 0.8919 | 1.0000 | 1.0000 | 1.19e-11 | 7uoe:P |
4 | 8sq9:T | 35 | 33 | 0.8919 | 0.9429 | 1.0000 | 1.19e-11 | 7uo9:T |
5 | 8sq9:P | 32 | 32 | 0.8649 | 1.0000 | 1.0000 | 4.28e-11 | 7uo9:P |
6 | 8sqj:T | 35 | 34 | 0.8919 | 0.9429 | 0.9706 | 1.54e-10 | 8sqk:T |
7 | 8sqj:P | 32 | 31 | 0.8378 | 0.9688 | 1.0000 | 1.54e-10 | 8sqk:P |