gugagauugugaagggaucucgcagguaucgugagggaaguaugggguaguacgagaggaacucccaugccgugccucua
guuucugggguuugucgaacggcaagugccccgaagccaucgcacggugguucucggcugaacgccucuaagccagaagc
caaucccaagaccagaugcccac
The query sequence (length=183) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8a98:4 | 183 | 183 | 1.0000 | 1.0000 | 1.0000 | 4.19e-94 | 6az3:4 |
2 | 8rxh:L4 | 184 | 183 | 0.9945 | 0.9891 | 0.9945 | 1.95e-92 | 8rxx:L4 |
3 | 8ovj:4 | 183 | 183 | 0.9945 | 0.9945 | 0.9945 | 1.95e-92 | |
4 | 5t2a:G | 183 | 183 | 0.9891 | 0.9891 | 0.9891 | 9.08e-91 | |
5 | 4v8m:BG | 182 | 181 | 0.9290 | 0.9341 | 0.9392 | 1.20e-74 | |
6 | 8ova:BG | 183 | 181 | 0.9290 | 0.9290 | 0.9392 | 1.20e-74 | 8ove:BG |
7 | 8a3w:4 | 158 | 170 | 0.8634 | 1.0000 | 0.9294 | 1.57e-63 | |
8 | 3jcs:4 | 149 | 159 | 0.8142 | 1.0000 | 0.9371 | 2.63e-61 |