BioLiP

>rna
gugacuauagcaaggaggucacaccuguucccaugccgaacacagaaguuaagcuccuuagcgucgaugguagucgaacu
uacguuccgcuagaguagaacguu

The query sequence (length=104) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	7ttu:2	111	104	1.0000	0.9369	1.0000	1.81e-50	7ttw:2
2	6s0z:B	114	104	1.0000	0.9123	1.0000	1.81e-50
3	7nhl:B	113	104	1.0000	0.9204	1.0000	1.81e-50	7nhm:B, 8p2f:B, 8p2g:B, 8p2h:B, 7p48:B
4	6ddd:2	104	104	1.0000	1.0000	1.0000	1.81e-50	6ddg:2
5	7asm:B	115	104	1.0000	0.9043	1.0000	1.81e-50	6fxc:AB, 6fxc:BB, 6hma:B, 5ngm:AB, 6s0x:B, 6s12:B, 6s13:B, 8y36:B, 8y37:B, 8y38:B, 8y39:B, 6yef:B
6	6sj6:B	112	104	0.9904	0.9196	0.9904	3.02e-48
7	6wru:2	112	104	0.9808	0.9107	0.9808	3.91e-47
8	6wqn:2	111	104	0.9808	0.9189	0.9808	3.91e-47	6wqq:2, 6wrs:2
9	5t7v:C	114	104	0.9808	0.8947	0.9808	1.41e-46
10	7aso:C	114	104	0.9519	0.8684	0.9519	1.42e-41	7asp:3, 5hkv:Y, 5hl7:Y, 5li0:B, 5nd8:B, 5nd9:B, 5nrg:Y, 5tcu:C, 4wce:Y, 4wf9:Y, 4wfa:Y, 4wfb:Y
11	7asn:B	106	96	0.8942	0.8774	0.9688	6.59e-40
12	6o8w:B	116	78	0.6538	0.5862	0.8718	8.76e-19	6o8x:B, 6o8y:B, 6o8z:B, 6o90:B, 6w6p:B, 6wu9:B
13	7nhk:B	114	78	0.6538	0.5965	0.8718	8.76e-19	7p7q:B, 7p7r:B, 7p7s:B, 7p7t:B, 7p7u:B

[Back]