gucuccguaguguagcgguuaucacguucgccuaacacgcgaaagguccucgguucgaaaccgggcggaaacacca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7a5g:j | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 6fti:q, 6hcf:23, 6hcm:23, 3jag:2, 3jah:2, 3jai:2, 5lzs:2, 5lzs:ii, 5lzt:2, 5lzu:2, 5lzv:2, 5lzw:2, 5lzx:2, 5lzz:2, 7nwi:2, 8rjb:q, 8rjd:q, 8scb:2, 7tut:q |
2 | 7nwg:q3 | 74 | 76 | 0.9737 | 1.0000 | 0.9737 | 3.46e-31 | |
3 | 6frk:2 | 76 | 76 | 0.9605 | 0.9605 | 0.9605 | 4.48e-30 | 6gz3:Bv, 6gz4:Bv, 6gz5:Bv, 3jaj:3, 3jan:3, 8p2k:AT |
4 | 6ahu:T | 72 | 72 | 0.9079 | 0.9583 | 0.9583 | 7.49e-28 |