BioLiP

>rna
gucgacguacuucauaggaucauuucacucuuugacucuucaaaagagccacugaauccaacuugguugaugaccuuugu
accccagagugagccguugcauuuuauggcgcgaugaucuugacccauggguggguacaaauggcagucugacaagu

The query sequence (length=157) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.

#	Hit	Hit length	Aligned length	Identity (normalized by query)	Identity (normalized by hit)	Identity (normalized by aligned length)	E-value	Homologs to hit
1	5wyj:3A	157	157	1.0000	1.0000	1.0000	1.00e-79	5wyk:3A
2	6lqt:3A	194	157	0.8471	0.6856	0.8471	4.96e-33
3	6zqa:D4	175	144	0.7834	0.7029	0.8542	1.79e-32	6zqb:D4
4	7d5t:3A	167	94	0.5541	0.5210	0.9255	2.31e-31
5	7d5s:3A	175	144	0.7771	0.6971	0.8472	8.31e-31	7d63:3A, 6ke6:3A, 6lqp:3A, 6lqq:3A, 6lqr:3A, 6lqu:3A, 6lqv:3A
6	7suk:L2	169	138	0.7325	0.6805	0.8333	1.80e-27	5wlc:L2
7	6nd4:2	146	138	0.7325	0.7877	0.8333	1.80e-27
8	6zqc:D4	230	49	0.3121	0.2130	1.0000	1.09e-19
9	6zqc:D4	230	53	0.3248	0.2217	0.9623	5.07e-18
10	6lqs:3A	234	49	0.3121	0.2094	1.0000	1.09e-19
11	6lqs:3A	234	36	0.2293	0.1538	1.0000	1.84e-12
12	6lqs:3A	234	29	0.1847	0.1239	1.0000	1.43e-08
13	7ajt:D4	230	49	0.3121	0.2130	1.0000	1.09e-19
14	7ajt:D4	230	53	0.3248	0.2217	0.9623	5.07e-18
15	5tzs:2	126	114	0.5987	0.7460	0.8246	5.07e-18
16	6zqd:D4	223	53	0.3185	0.2242	0.9434	8.48e-16	6zqe:D4
17	7aju:D4	223	53	0.3185	0.2242	0.9434	8.48e-16
18	7d4i:3A	216	36	0.2293	0.1667	1.0000	1.84e-12
19	7d4i:3A	216	31	0.1975	0.1435	1.0000	1.11e-09

[Back]