guccgcaugccguaucgggccuuggguucuaaccuguucuguaggcuuaugcagcggac
The query sequence (length=59) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8wt7:E | 59 | 59 | 1.0000 | 1.0000 | 1.0000 | 9.04e-26 | |
| 2 | 8wt8:E | 59 | 59 | 0.9661 | 0.9661 | 0.9661 | 1.96e-22 | 8wt9:E |
| 3 | 8wt6:E | 59 | 59 | 0.9322 | 0.9322 | 0.9322 | 4.23e-19 |
umich.edu