guaccgcuccagucguucaugguuuuaguacucuggaaacagaaucuacuaaaacaaggcaaaaugccguguuuaucucg
ucaacuuguuggcgagauuuuuuu
The query sequence (length=104) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7vw3:B | 104 | 104 | 1.0000 | 1.0000 | 1.0000 | 1.81e-50 | |
| 2 | 7enr:B | 92 | 77 | 0.7308 | 0.8261 | 0.9870 | 3.09e-33 | |
| 3 | 8jft:B | 86 | 77 | 0.7212 | 0.8721 | 0.9740 | 1.44e-31 | 8jg9:B, 8jg9:E |
| 4 | 7eni:B | 69 | 53 | 0.5096 | 0.7681 | 1.0000 | 4.05e-22 | |
| 5 | 5axw:B | 73 | 53 | 0.5096 | 0.7260 | 1.0000 | 4.05e-22 | 5czz:B, 7el1:B |
| 6 | 5y36:B | 99 | 28 | 0.2692 | 0.2828 | 1.0000 | 3.20e-08 |
umich.edu