ggugggguucccgagcggccaaagggagcagacuguaaaucugccgucaucgacuucgaagguucgaauccuucccccac
cacca
The query sequence (length=85) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6n1d:BATN | 85 | 85 | 1.0000 | 1.0000 | 1.0000 | 5.11e-40 | 4v8d:AB, 4v8d:AD, 4v8d:CB, 4v8d:CD, 4v8e:BB, 4v8e:BD, 4v8e:DB, 4v8e:DD, 4v8f:BB, 4v8f:BD, 4v8f:CB, 4v8f:CD, 4wq1:1K, 4wr6:1K, 4wr6:3K, 4wr6:3L, 4wra:1K, 4wra:3K, 4wra:3L, 4wu1:3K, 4wu1:3L, 4wzd:3K, 4wzd:3L |
2 | 6k0b:U | 83 | 83 | 0.9647 | 0.9880 | 0.9880 | 3.08e-37 | 6k0b:V |
3 | 4wu1:2K | 82 | 85 | 0.9647 | 1.0000 | 0.9647 | 6.66e-34 | 4wzd:2K |
4 | 4wu1:2L | 78 | 85 | 0.9176 | 1.0000 | 0.9176 | 4.04e-26 | 4wzd:2L |
5 | 4wq1:3L | 75 | 85 | 0.8824 | 1.0000 | 0.8824 | 1.46e-20 | |
6 | 4wq1:3K | 74 | 85 | 0.8706 | 1.0000 | 0.8706 | 2.45e-18 | 4wq1:1L |