ggucuuguagcucagucgguagagcaacggucugaagaaccgugugucggcaguucgauucugcccgagaccacca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7p6z:7 | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 7pah:7, 7pah:8, 7pai:7, 7paj:6, 7paj:7, 7paj:8, 7pak:6, 7pak:7, 7pal:6, 7pal:7, 7pam:8, 7pan:7, 7pan:8, 7pao:8, 7paq:7, 7paq:8, 7par:7, 7par:8, 7ph9:7, 7pha:6, 7pha:7, 7phb:6, 7phb:7, 7phc:8, 7pi8:7, 7pi9:6, 7pi9:7, 7pia:7, 7pia:8, 7pib:7, 7pib:8, 7pic:8, 7pio:7, 7pip:6, 7pip:7, 7piq:7, 7pir:8, 7pis:6, 7pis:8, 7pit:7, 7pit:8 |
umich.edu