ggucaauuugaaacaauacagagaugaucagcaguuccccugcauaaggaugaaccguuuuacaaagagac
The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5tf6:B | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 2.44e-32 | |
2 | 5y88:D | 101 | 70 | 0.9859 | 0.6931 | 1.0000 | 8.78e-32 | |
3 | 5mps:6 | 99 | 70 | 0.9859 | 0.7071 | 1.0000 | 8.78e-32 | 5mq0:6 |
4 | 5lj3:V | 97 | 70 | 0.9859 | 0.7216 | 1.0000 | 8.78e-32 | 5lj5:V |
5 | 7dco:F | 103 | 70 | 0.9859 | 0.6796 | 1.0000 | 8.78e-32 | 5gm6:E, 5gmk:E, 6j6g:E, 6j6h:E, 6j6n:E, 6j6q:E, 5wsg:E, 5ylz:D |
6 | 7b9v:6 | 102 | 70 | 0.9859 | 0.6863 | 1.0000 | 8.78e-32 | 6bk8:6, 6exn:6, 5lqw:6 |
7 | 5vsu:I | 73 | 66 | 0.9014 | 0.8767 | 0.9697 | 1.14e-25 | |
8 | 6aso:I | 70 | 66 | 0.8873 | 0.9000 | 0.9545 | 5.32e-24 | |
9 | 5nrl:6 | 95 | 70 | 0.9014 | 0.6737 | 0.9143 | 4.14e-20 | |
10 | 4n0t:B | 65 | 71 | 0.9014 | 0.9846 | 0.9014 | 5.36e-19 | |
11 | 5zwm:F | 99 | 58 | 0.7606 | 0.5455 | 0.9310 | 2.49e-17 | 5zwo:F |
12 | 5tf6:D | 52 | 34 | 0.4789 | 0.6538 | 1.0000 | 9.03e-12 | |
13 | 3jcm:D | 45 | 48 | 0.6197 | 0.9778 | 0.9167 | 9.03e-12 | |
14 | 5gap:W | 56 | 59 | 0.7324 | 0.9286 | 0.8814 | 9.03e-12 | |
15 | 5gan:W | 80 | 59 | 0.7324 | 0.6500 | 0.8814 | 9.03e-12 |