gggugguggccauuuuuugucuaacccuaacugagaagggcguaggcgccgugcuuuugcuccccgcgcgcuguuuuucu
cgcugacuuucagcgggcggaaaagccucggccugccgccuuccgagcaaacaaaaaaugucagcugcuggcccguucgc
cccgaaccccgccgaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucuguc
agccgcgggucucucg
The query sequence (length=256) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7bg9:B | 256 | 256 | 1.0000 | 1.0000 | 1.0000 | 1.60e-134 | 7qxb:B, 7qxs:B |
| 2 | 7qxa:B | 253 | 256 | 0.9883 | 1.0000 | 0.9883 | 2.08e-128 | |
| 3 | 7v99:R | 243 | 251 | 0.9375 | 0.9877 | 0.9562 | 4.60e-110 | |
| 4 | 7trd:B | 217 | 237 | 0.8477 | 1.0000 | 0.9156 | 4.76e-85 | 7tre:B, 7trf:B |
umich.edu