gggucguuagcucauggagcaguugacuuuuaaucaauugcgcagguucgaauccugcacgacccacca
The query sequence (length=69) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5e81:1L | 69 | 69 | 1.0000 | 1.0000 | 1.0000 | 3.04e-31 | |
2 | 5ib7:1L | 66 | 66 | 0.9565 | 1.0000 | 1.0000 | 1.41e-29 | 5ib8:1L |
3 | 5e7k:1K | 71 | 71 | 1.0000 | 0.9718 | 0.9718 | 1.83e-28 | |
4 | 5el4:1K | 69 | 70 | 0.9855 | 0.9855 | 0.9714 | 6.57e-28 | 5el5:1K, 5el6:1K, 5el7:1K |
5 | 5e81:1K | 72 | 72 | 1.0000 | 0.9583 | 0.9583 | 8.50e-27 | 5ib7:1K, 5ib8:1K |
6 | 5e81:3K | 70 | 70 | 0.9710 | 0.9571 | 0.9571 | 3.06e-26 | 5ib7:3K, 5ib8:3K |
7 | 5e7k:1L | 73 | 73 | 1.0000 | 0.9452 | 0.9452 | 1.10e-25 | 5el6:1L |
8 | 5e81:3L | 72 | 72 | 0.9855 | 0.9444 | 0.9444 | 3.96e-25 | |
9 | 7zta:PTR1 | 73 | 73 | 0.9855 | 0.9315 | 0.9315 | 5.12e-24 | |
10 | 5el4:1L | 74 | 74 | 1.0000 | 0.9324 | 0.9324 | 5.12e-24 | 5el5:1L |
11 | 5el4:3L | 74 | 74 | 0.9855 | 0.9189 | 0.9189 | 2.38e-22 | |
12 | 8bhj:5 | 76 | 76 | 1.0000 | 0.9079 | 0.9079 | 3.08e-21 | 8bhn:5, 5e7k:3K, 5e7k:3L, 5el4:3K, 5el5:3K, 5el6:3K, 5el7:3K, 5gak:A, 6hd7:A, 5mc6:m, 7n1p:Pt, 7n2c:Pt, 7n2v:Pt, 7n31:Pt, 7nrc:Sm, 6tnu:m, 5uyn:Y, 5uyp:Y, 5uyq:Y |
13 | 8fom:QV | 74 | 74 | 0.9710 | 0.9054 | 0.9054 | 1.11e-20 | 8fom:XV, 8fon:QV, 8fon:XV |
14 | 7rr5:A | 76 | 76 | 0.9855 | 0.8947 | 0.8947 | 1.43e-19 | |
15 | 5el7:3L | 75 | 76 | 0.9855 | 0.9067 | 0.8947 | 1.43e-19 |