gggucguuagcucauggagcaguugacuuuuaaucaauugcgcagguucgaauccugcacgaccca
The query sequence (length=66) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5ib7:1L | 66 | 66 | 1.0000 | 1.0000 | 1.0000 | 1.33e-29 | 5ib8:1L |
| 2 | 5e81:1L | 69 | 66 | 1.0000 | 0.9565 | 1.0000 | 1.33e-29 | |
| 3 | 5e7k:1L | 73 | 70 | 1.0000 | 0.9041 | 0.9429 | 4.81e-24 | 5el6:1L |
umich.edu