gggucguuagcucaggagagcaguugacuuuuaaucaauuggucgcagguucgaauccugcacgacccacca
The query sequence (length=72) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5e81:3L | 72 | 72 | 1.0000 | 1.0000 | 1.0000 | 6.92e-33 | |
2 | 5el4:3L | 74 | 74 | 1.0000 | 0.9730 | 0.9730 | 4.16e-30 | |
3 | 5e81:1K | 72 | 73 | 0.9861 | 0.9861 | 0.9726 | 1.50e-29 | 5ib7:1K, 5ib8:1K |
4 | 8fom:QV | 74 | 74 | 0.9861 | 0.9595 | 0.9595 | 1.94e-28 | 8fom:XV, 8fon:QV, 8fon:XV |
5 | 7zta:PTR1 | 73 | 74 | 0.9861 | 0.9726 | 0.9595 | 6.97e-28 | |
6 | 5e81:3K | 70 | 72 | 0.9583 | 0.9857 | 0.9583 | 2.51e-27 | 5ib7:3K, 5ib8:3K |
7 | 5e7k:1K | 71 | 72 | 0.9583 | 0.9718 | 0.9583 | 2.51e-27 | |
8 | 8bhj:5 | 76 | 76 | 1.0000 | 0.9474 | 0.9474 | 2.51e-27 | 8bhn:5, 5e7k:3K, 5e7k:3L, 5el4:3K, 5el5:3K, 5el6:3K, 5el7:3K, 5gak:A, 6hd7:A, 5mc6:m, 7n1p:Pt, 7n2c:Pt, 7n2v:Pt, 7n31:Pt, 7nrc:Sm, 6tnu:m, 5uyn:Y, 5uyp:Y, 5uyq:Y |
9 | 7rr5:A | 76 | 76 | 0.9861 | 0.9342 | 0.9342 | 1.17e-25 | |
10 | 5el7:3L | 75 | 76 | 0.9861 | 0.9467 | 0.9342 | 4.19e-25 | |
11 | 5el4:1L | 74 | 75 | 0.9722 | 0.9459 | 0.9333 | 4.19e-25 | 5el5:1L |
12 | 5e81:1L | 69 | 72 | 0.9444 | 0.9855 | 0.9444 | 4.19e-25 | |
13 | 5el4:1K | 69 | 72 | 0.9306 | 0.9710 | 0.9306 | 1.95e-23 | 5el5:1K, 5el6:1K, 5el7:1K |
14 | 5e7k:1L | 73 | 75 | 0.9583 | 0.9452 | 0.9200 | 7.02e-23 | 5el6:1L |