ggguacgaccauacuuggccgaaugcaccauaucccguccgauuugugaaguuaagcggccacaggccucguuaguacgg
cgaucagugauggcgcuggaacccgggguguuguacucu
The query sequence (length=119) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8ova:BD | 119 | 119 | 1.0000 | 1.0000 | 1.0000 | 9.74e-59 | 8ove:BD, 4v8m:BD |
2 | 5t5h:D | 114 | 110 | 0.8739 | 0.9123 | 0.9455 | 1.29e-42 | |
3 | 6az3:8 | 118 | 117 | 0.8151 | 0.8220 | 0.8291 | 1.02e-23 | |
4 | 8rxh:L8 | 120 | 117 | 0.8067 | 0.8000 | 0.8205 | 4.76e-22 | |
5 | 8a3w:8 | 119 | 117 | 0.8067 | 0.8067 | 0.8205 | 4.76e-22 | 8ovj:8, 8rxx:L8, 5t2a:D |
6 | 3jcs:8 | 119 | 117 | 0.8067 | 0.8067 | 0.8205 | 1.71e-21 | |
7 | 8a98:8 | 118 | 118 | 0.8067 | 0.8136 | 0.8136 | 2.22e-20 |