ggggugaaggaggcuucggccgcgaaacuucacccc
The query sequence (length=36) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 2hw8:B | 36 | 36 | 1.0000 | 1.0000 | 1.0000 | 2.56e-13 | |
| 2 | 1zho:B | 38 | 38 | 1.0000 | 0.9474 | 0.9474 | 1.54e-10 | 1zho:D, 1zho:F, 1zho:H |
umich.edu