ggggcuauagcucagaagggagagcgcuugcaugccaugcaagaggucagcgguucgaucccgcuuagcuccacca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6of6:QW | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 6of6:XW |
2 | 6oj2:QW | 76 | 76 | 0.9737 | 0.9737 | 0.9737 | 9.63e-32 | 6oj2:XW |
3 | 6oj2:XY | 76 | 76 | 0.9605 | 0.9605 | 0.9605 | 4.48e-30 | 8pkl:Y, 8r3v:Y2, 8rcl:Y2, 8rcm:Y2, 8rcs:Y, 8rct:Y |
4 | 6of6:QY | 75 | 75 | 0.9474 | 0.9600 | 0.9600 | 1.61e-29 | 6of6:XY, 6oj2:QY |
5 | 6ord:XY | 76 | 76 | 0.9342 | 0.9342 | 0.9342 | 9.69e-27 | |
6 | 6ope:QY | 75 | 75 | 0.9211 | 0.9333 | 0.9333 | 3.49e-26 | 6ope:XY |
7 | 3vjr:B | 36 | 28 | 0.3684 | 0.7778 | 1.0000 | 2.14e-08 | 3vjr:D |