ggggcgguagcucagccugggagagcaccggacugaagauccgggugucggggguucaaaucccccccgcccc
The query sequence (length=73) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5wt3:C | 73 | 73 | 1.0000 | 1.0000 | 1.0000 | 1.96e-33 | |
| 2 | 4v6u:A1 | 77 | 73 | 1.0000 | 0.9481 | 1.0000 | 1.96e-33 | |
| 3 | 5wt1:F | 68 | 68 | 0.9315 | 1.0000 | 1.0000 | 1.18e-30 | |
| 4 | 5wt1:C | 67 | 67 | 0.9178 | 1.0000 | 1.0000 | 4.24e-30 |
umich.edu