ggggccuuagcucaggggagagcgccugcuuugcacgcaggaggcagcgguucgaucccgcuaggcuccacca
The query sequence (length=73) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 7as8:2 | 73 | 73 | 1.0000 | 1.0000 | 1.0000 | 1.96e-33 | |
2 | 7as9:2 | 75 | 75 | 1.0000 | 0.9733 | 0.9733 | 1.18e-30 | |
3 | 7aqc:T | 76 | 76 | 1.0000 | 0.9605 | 0.9605 | 5.49e-29 | 7aqd:T |
4 | 7ope:2 | 70 | 74 | 0.9452 | 0.9857 | 0.9324 | 5.53e-24 | |
5 | 7aqc:P | 69 | 74 | 0.9315 | 0.9855 | 0.9189 | 2.57e-22 | 8s1p:a, 8s1u:a |
6 | 6q9a:7 | 76 | 77 | 0.9452 | 0.9079 | 0.8961 | 1.20e-20 | 8qbt:7, 8vs9:ATRN, 8vsa:ATRN |