gggcguguggcguagucgagcgcgcucccuuagcaugggagaggucuccgguucgauuccggacucguccgccaa
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 8agt:x | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | |
| 2 | 8aaf:x | 74 | 74 | 0.9867 | 1.0000 | 1.0000 | 5.65e-34 | 8agv:x, 8agw:x, 8agx:x, 8agz:x |
| 3 | 8aaf:y | 73 | 74 | 0.9733 | 1.0000 | 0.9865 | 9.46e-32 | 8agt:y, 8agu:y, 8agv:y, 8agw:y, 8agx:y, 8agz:y |
| 4 | 6r84:B | 76 | 76 | 0.9867 | 0.9737 | 0.9737 | 3.40e-31 | 6r87:B, 7zw0:sn |
| 5 | 9bdp:TIRN | 70 | 76 | 0.8933 | 0.9571 | 0.8816 | 7.47e-18 |
umich.edu