gggccgggcgcgguggcgcgcgccuguagucccagcuacucgggaggcuc
The query sequence (length=50) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 1e8o:E | 50 | 50 | 1.0000 | 1.0000 | 1.0000 | 7.10e-21 | |
| 2 | 1ry1:E | 49 | 49 | 0.9800 | 1.0000 | 1.0000 | 2.55e-20 | |
| 3 | 4ue5:A | 299 | 47 | 0.9400 | 0.1572 | 1.0000 | 3.30e-19 | |
| 4 | 6r6g:AF | 206 | 47 | 0.9400 | 0.2282 | 1.0000 | 3.30e-19 | |
| 5 | 7nfx:1 | 249 | 47 | 0.9400 | 0.1888 | 1.0000 | 3.30e-19 | 7obr:1 |
| 6 | 3jaj:4 | 206 | 47 | 0.9400 | 0.2282 | 1.0000 | 3.30e-19 | 3jan:4 |
| 7 | 6frk:1 | 258 | 47 | 0.9400 | 0.1822 | 1.0000 | 3.30e-19 |
umich.edu