gggaugcguaggauaggugggagcgcaagcgccggugaaauaccacccuuccc
The query sequence (length=53) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4v91:1 | 3203 | 53 | 1.0000 | 0.0165 | 1.0000 | 1.67e-22 | |
| 2 | 4v4b:B3 | 2863 | 53 | 1.0000 | 0.0185 | 1.0000 | 1.67e-22 | |
| 3 | 2noq:E | 53 | 53 | 1.0000 | 1.0000 | 1.0000 | 1.67e-22 |
umich.edu