ggcucuguuuaccaggucagguccgaaaggaagcagccaaggcagagcc
The query sequence (length=49) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 1dul:B | 49 | 49 | 1.0000 | 1.0000 | 1.0000 | 2.48e-20 | 1hq1:B, 3lqx:B |
2 | 2xkv:B | 96 | 46 | 0.9388 | 0.4792 | 1.0000 | 1.15e-18 | |
3 | 2j28:8 | 74 | 46 | 0.9388 | 0.6216 | 1.0000 | 1.15e-18 | |
4 | 2pxu:B | 49 | 45 | 0.8980 | 0.8980 | 0.9778 | 1.93e-16 | |
5 | 2pxe:B | 49 | 45 | 0.8980 | 0.8980 | 0.9778 | 1.93e-16 | |
6 | 2pxb:B | 49 | 45 | 0.8980 | 0.8980 | 0.9778 | 1.93e-16 | |
7 | 2pxt:B | 49 | 45 | 0.8980 | 0.8980 | 0.9778 | 6.93e-16 | |
8 | 2pxq:B | 49 | 45 | 0.8980 | 0.8980 | 0.9778 | 6.93e-16 | |
9 | 2pxp:B | 49 | 41 | 0.8367 | 0.8367 | 1.0000 | 6.93e-16 | |
10 | 2pxd:B | 49 | 41 | 0.8367 | 0.8367 | 1.0000 | 6.93e-16 | |
11 | 2pxv:B | 49 | 39 | 0.7959 | 0.7959 | 1.0000 | 8.97e-15 | |
12 | 2pxl:B | 47 | 39 | 0.7959 | 0.8298 | 1.0000 | 8.97e-15 | |
13 | 2pxk:B | 49 | 39 | 0.7959 | 0.7959 | 1.0000 | 8.97e-15 | |
14 | 2pxf:B | 49 | 39 | 0.7959 | 0.7959 | 1.0000 | 8.97e-15 |