ggcucguuggucuagggguaugauucucgcuuagggugcgagaggucccggguucaaaucccggacgagcc
The query sequence (length=71) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 2ms0:B | 71 | 71 | 1.0000 | 1.0000 | 1.0000 | 2.44e-32 | 2ms1:B |
2 | 6ip5:zy | 75 | 71 | 1.0000 | 0.9467 | 1.0000 | 2.44e-32 | 6ip5:zu, 6ip6:zy, 6ip8:zy, 7o81:AT |