ggcggcuaaagagugcagaguuacuuaguucacugcagacgc
The query sequence (length=42) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4m6d:L | 43 | 42 | 1.0000 | 0.9767 | 1.0000 | 1.49e-16 | |
| 2 | 4m6d:D | 42 | 42 | 1.0000 | 1.0000 | 1.0000 | 1.49e-16 | 4m6d:H |
| 3 | 4m6d:B | 41 | 41 | 0.9762 | 1.0000 | 1.0000 | 5.37e-16 | 4m6d:F, 4m6d:J |
| 4 | 4m4o:B | 59 | 37 | 0.8810 | 0.6271 | 1.0000 | 8.98e-14 |
umich.edu