ggcggcguagcucagcuggucagagcggggaucucauaagucccaggucggagguucgaguccucccgccgccac
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 2csx:C | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | 2csx:D |
| 2 | 2ct8:C | 74 | 74 | 0.9867 | 1.0000 | 1.0000 | 5.65e-34 | 2ct8:D |
umich.edu