ggcccggggcgguucgauuccgcccugggccauc
The query sequence (length=34) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 2zhb:B | 34 | 34 | 1.0000 | 1.0000 | 1.0000 | 2.96e-12 | |
2 | 2zh9:B | 33 | 33 | 0.9706 | 1.0000 | 1.0000 | 1.07e-11 | 2zha:B |
3 | 2zh8:B | 34 | 32 | 0.9412 | 0.9412 | 1.0000 | 3.83e-11 | |
4 | 2zh7:B | 33 | 32 | 0.9412 | 0.9697 | 1.0000 | 3.83e-11 | |
5 | 2zh5:B | 34 | 32 | 0.9412 | 0.9412 | 1.0000 | 3.83e-11 | 2zh6:B |
6 | 2zh4:B | 34 | 32 | 0.9412 | 0.9412 | 1.0000 | 3.83e-11 | |
7 | 2zh3:B | 34 | 32 | 0.9412 | 0.9412 | 1.0000 | 3.83e-11 | |
8 | 2zh2:B | 34 | 32 | 0.9412 | 0.9412 | 1.0000 | 3.83e-11 | |
9 | 2zh1:B | 33 | 32 | 0.9412 | 0.9697 | 1.0000 | 3.83e-11 | |
10 | 2drb:B | 35 | 32 | 0.9412 | 0.9143 | 1.0000 | 3.83e-11 | |
11 | 2dr9:B | 34 | 32 | 0.9412 | 0.9412 | 1.0000 | 3.83e-11 | 2dra:B, 2dvi:B |
12 | 2dr7:B | 33 | 32 | 0.9412 | 0.9697 | 1.0000 | 3.83e-11 | 2dr8:B |
13 | 2dr5:B | 32 | 32 | 0.9412 | 1.0000 | 1.0000 | 3.83e-11 |