ggcccggauagcucagucgguagagcaucagacuuuuaaucugaggguccaggguucaagucccuguucgggcgcc
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5cd1:N | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | |
| 2 | 5ccb:N | 77 | 76 | 1.0000 | 0.9870 | 1.0000 | 4.45e-35 | 5ccx:N |
| 3 | 6sgc:23 | 76 | 75 | 0.9605 | 0.9605 | 0.9733 | 3.46e-31 | 6sgc:33 |
| 4 | 7nwg:33 | 75 | 76 | 0.9737 | 0.9867 | 0.9737 | 3.46e-31 | |
| 5 | 5cd1:M | 74 | 76 | 0.9737 | 1.0000 | 0.9737 | 3.46e-31 | |
| 6 | 3jag:3 | 75 | 75 | 0.9605 | 0.9733 | 0.9733 | 1.25e-30 | 3jah:3, 3jai:3, 5lzs:3, 5lzt:3, 5lzu:3, 5lzv:3, 5lzw:3, 5lzx:3, 5lzy:2, 5lzy:3, 5lzz:3, 6mtb:4, 6mtc:4, 8scb:3 |
| 7 | 6r5q:3 | 75 | 75 | 0.9342 | 0.9467 | 0.9467 | 2.70e-27 | 6r6g:3, 6r6p:3, 6r7q:3 |
| 8 | 7mrl:A | 75 | 73 | 0.8684 | 0.8800 | 0.9041 | 1.26e-20 | |
| 9 | 8d9k:C | 65 | 72 | 0.8553 | 1.0000 | 0.9028 | 5.88e-19 | 8d9l:C, 8eg0:C |
| 10 | 6wb1:D | 42 | 30 | 0.3947 | 0.7143 | 1.0000 | 1.66e-09 | 6wb2:D |
umich.edu