ggccccuuagcucagugguuagagcaggcgacucauaaucgcuuggucgcugguucaaguccagcaggggccacca
The query sequence (length=76) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8g7p:w | 76 | 76 | 1.0000 | 1.0000 | 1.0000 | 4.45e-35 | 8g7p:y, 8g7q:w, 8g7q:y, 8g7r:w, 8g7r:y, 8g7s:x, 8g7s:y |
2 | 8hsp:X | 76 | 76 | 0.9868 | 0.9868 | 0.9868 | 2.07e-33 | 8hu1:X |
3 | 8akn:Z | 76 | 76 | 0.9868 | 0.9868 | 0.9868 | 2.07e-33 | |
4 | 8r6c:Y | 73 | 76 | 0.9605 | 1.0000 | 0.9605 | 5.79e-29 |