ggccauuuuuugucuaacccuaacugagaagggcguaggcgccgugcuuuugcuccccgcgcgcuguuuuucucgcugac
uuucagcgggcggaaaagccucggccugccgccuuccgagcaaacaaaaaaugucagcugcuggccgaggccgcggucgg
cccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagcc
The query sequence (length=217) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7trd:B | 217 | 217 | 1.0000 | 1.0000 | 1.0000 | 6.37e-113 | 7tre:B, 7trf:B |
| 2 | 7v99:R | 243 | 232 | 0.9908 | 0.8848 | 0.9267 | 6.60e-88 | |
| 3 | 7bg9:B | 256 | 237 | 1.0000 | 0.8477 | 0.9156 | 3.97e-85 | 7qxb:B, 7qxs:B |
| 4 | 7qxa:B | 253 | 237 | 0.9862 | 0.8458 | 0.9030 | 5.18e-79 |
umich.edu