ggccagguagcucaguugguagagcacuggacugaaaauccaggugucggcgguucgauuccgccccuggccacc
The query sequence (length=75) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4wc2:B | 75 | 75 | 1.0000 | 1.0000 | 1.0000 | 1.57e-34 | 4wc6:B, 4wc7:B, 3wfr:C, 3wfr:D |
| 2 | 5hc9:C | 76 | 75 | 1.0000 | 0.9868 | 1.0000 | 1.57e-34 | 5hc9:D, 4wc3:B |
| 3 | 4wc4:B | 74 | 74 | 0.9867 | 1.0000 | 1.0000 | 5.65e-34 | 4wc5:B, 3wfr:A, 3wfr:B, 3wfs:A, 3wfs:B |
| 4 | 3wfq:A | 73 | 73 | 0.9733 | 1.0000 | 1.0000 | 2.03e-33 | 3wfq:B, 3wfq:C, 3wfq:D |
| 5 | 4x0b:B | 77 | 76 | 1.0000 | 0.9740 | 0.9868 | 7.31e-33 | |
| 6 | 4x0a:B | 73 | 72 | 0.9467 | 0.9726 | 0.9861 | 1.22e-30 |
umich.edu