ggcauugugccucgcauugcacuccgcggggcgauaaguccugaaaagggauguc
The query sequence (length=55) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 6las:A | 55 | 55 | 1.0000 | 1.0000 | 1.0000 | 1.36e-23 | 6las:B, 6lau:B, 6laz:A, 6laz:B |
| 2 | 6lau:A | 54 | 54 | 0.9818 | 1.0000 | 1.0000 | 4.91e-23 | |
| 3 | 6lax:A | 55 | 55 | 0.9818 | 0.9818 | 0.9818 | 6.35e-22 | 6lax:B |
umich.edu