ggauccauugcacuccggauccaggagauaccaugaucacgaaggugguuuuccu
The query sequence (length=55) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4pkd:V | 55 | 55 | 1.0000 | 1.0000 | 1.0000 | 1.36e-23 | |
| 2 | 8r08:1 | 153 | 31 | 0.5636 | 0.2026 | 1.0000 | 3.00e-10 | |
| 3 | 7b0y:a | 164 | 31 | 0.5636 | 0.1890 | 1.0000 | 3.00e-10 | 6qx9:1, 7vpx:L |
umich.edu