ggaggucaacaucaagaacugugggccuuugccuauagaacuuauaacgaacaugguucuugccuuuuaccagaaccauc
cggguguugucuccauccauauuuuuuggaacuuuuc
The query sequence (length=117) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 5gm6:D | 117 | 117 | 1.0000 | 1.0000 | 1.0000 | 1.24e-57 | 5gmk:D, 5wsg:D, 5y88:B, 5ylz:B |
2 | 3jcm:F | 113 | 117 | 0.9658 | 1.0000 | 0.9658 | 7.49e-50 | |
3 | 7dco:B | 179 | 96 | 0.8205 | 0.5363 | 1.0000 | 5.83e-46 | 6j6g:D, 6j6h:D, 6j6n:D, 6j6q:D |
4 | 6bk8:5 | 103 | 96 | 0.8205 | 0.9320 | 1.0000 | 5.83e-46 | |
5 | 6exn:5 | 171 | 100 | 0.8205 | 0.5614 | 0.9600 | 2.11e-40 | |
6 | 7b9v:5 | 178 | 100 | 0.8205 | 0.5393 | 0.9600 | 2.11e-40 | |
7 | 5zwm:B | 175 | 96 | 0.7863 | 0.5257 | 0.9583 | 3.53e-38 | 5zwo:B |
8 | 5nrl:5 | 170 | 96 | 0.7863 | 0.5412 | 0.9583 | 3.53e-38 | |
9 | 5gam:U | 141 | 96 | 0.7863 | 0.6525 | 0.9583 | 3.53e-38 | 5gan:U, 5lj3:U, 5lj5:U, 5lqw:5, 5mps:5, 5mq0:5 |