ggagcgguaguucagucgguuagaauaccugccugucacgcagggggucgcggguucgagucccguccguuccgcca
The query sequence (length=77) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 1c0a:B | 77 | 77 | 1.0000 | 1.0000 | 1.0000 | 1.26e-35 | 5gak:B, 6hd7:B, 5jte:AX, 5ju8:AX, 5mc6:n |
| 2 | 1efw:C | 73 | 73 | 0.9481 | 1.0000 | 1.0000 | 2.11e-33 | 1efw:D |
umich.edu