ggaaauuaggugcgcuuggcguuuuagucccugaaaagggacuaaaauaaagaguuugcgggacucugcgggguuacaau
ccccuaaaaccgc
The query sequence (length=93) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5x2g:B | 93 | 93 | 1.0000 | 1.0000 | 1.0000 | 2.05e-44 | 5x2h:B |
| 2 | 5axw:B | 73 | 38 | 0.3763 | 0.4795 | 0.9211 | 2.78e-08 | 5czz:B, 7el1:B |
umich.edu