ggaaaccugaucauguagaucgaauggacucuaaauccguucagccggguuagauucccgggguuuccgc
The query sequence (length=70) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 5ud5:D | 72 | 70 | 1.0000 | 0.9722 | 1.0000 | 8.61e-32 | 5v6x:D |
| 2 | 5ud5:C | 70 | 70 | 1.0000 | 1.0000 | 1.0000 | 8.61e-32 | 5v6x:C |
umich.edu