gcugauauagcucaguugguagagcgcacccuuggugagggugaggucggcaguucgaaucugccuaucagca
The query sequence (length=73) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 4v5g:AY | 77 | 73 | 1.0000 | 0.9481 | 1.0000 | 1.96e-33 | 4v5g:CY |
| 2 | 5l3p:y | 73 | 73 | 1.0000 | 1.0000 | 1.0000 | 1.96e-33 | |
| 3 | 6gsj:3K | 72 | 73 | 0.9315 | 0.9444 | 0.9315 | 5.53e-24 | 6gsk:3K |
umich.edu