gcugauauagcucaguagagcgcacccuugguaagggugaggucggcaguucgaaucugccuaucagcacca
The query sequence (length=72) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6gsj:3K | 72 | 72 | 1.0000 | 1.0000 | 1.0000 | 6.92e-33 | 6gsk:3K |
2 | 6gsj:1K | 74 | 74 | 0.9861 | 0.9595 | 0.9595 | 1.94e-28 | 6gsj:1L, 6gsk:1L |
3 | 4v5g:AY | 77 | 76 | 0.9861 | 0.9221 | 0.9342 | 1.17e-25 | 4v5g:CY |
4 | 5l3p:y | 73 | 73 | 0.9444 | 0.9315 | 0.9315 | 5.43e-24 |