gcugagaauagaaguaggaguaugcuugcu
The query sequence (length=30) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7jtn:B | 30 | 30 | 1.0000 | 1.0000 | 1.0000 | 3.79e-10 | 7jtn:D |
| 2 | 7jtq:B | 31 | 29 | 0.9667 | 0.9355 | 1.0000 | 1.36e-09 | 7jtq:D |
umich.edu