gcucauuccaucucuuauguucgccuuagugccucauaaacuccggaaugacgcagagggugcuuaucguccacugacag
ucgcuuucaucagaugacacaacguugagugaagcacccacuuguaacgccugcuccguuaauaagagcaggcguuuuuu
The query sequence (length=160) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8b0j:K | 160 | 160 | 1.0000 | 1.0000 | 1.0000 | 2.20e-81 | |
2 | 8b0i:K | 103 | 51 | 0.3125 | 0.4854 | 0.9804 | 1.44e-18 |