gcggguguuuaccaggucagguccgaaaggaagcagccaaggcacuu
The query sequence (length=47) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 2pxl:B | 47 | 47 | 1.0000 | 1.0000 | 1.0000 | 3.00e-19 | |
2 | 2pxf:B | 49 | 45 | 0.9574 | 0.9184 | 1.0000 | 3.87e-18 | |
3 | 2pxv:B | 49 | 43 | 0.9149 | 0.8776 | 1.0000 | 5.01e-17 | |
4 | 2pxk:B | 49 | 41 | 0.8723 | 0.8367 | 1.0000 | 6.48e-16 | |
5 | 2xkv:B | 96 | 39 | 0.8298 | 0.4062 | 1.0000 | 8.39e-15 | |
6 | 2pxu:B | 49 | 39 | 0.8298 | 0.7959 | 1.0000 | 8.39e-15 | |
7 | 2pxt:B | 49 | 39 | 0.8298 | 0.7959 | 1.0000 | 8.39e-15 | |
8 | 2pxq:B | 49 | 39 | 0.8298 | 0.7959 | 1.0000 | 8.39e-15 | |
9 | 2pxp:B | 49 | 43 | 0.8936 | 0.8571 | 0.9767 | 8.39e-15 | |
10 | 2pxe:B | 49 | 39 | 0.8298 | 0.7959 | 1.0000 | 8.39e-15 | |
11 | 2pxd:B | 49 | 43 | 0.8936 | 0.8571 | 0.9767 | 8.39e-15 | |
12 | 2pxb:B | 49 | 39 | 0.8298 | 0.7959 | 1.0000 | 8.39e-15 | |
13 | 2j28:8 | 74 | 39 | 0.8298 | 0.5270 | 1.0000 | 8.39e-15 | |
14 | 1dul:B | 49 | 39 | 0.8298 | 0.7959 | 1.0000 | 8.39e-15 | 1hq1:B, 3lqx:B |