gcgggcguaguucaaggagaacgagagcuucccaagcucuauacgaggguucgauucccuucgcccgcucca
The query sequence (length=72) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7u2h:2w | 72 | 72 | 1.0000 | 1.0000 | 1.0000 | 6.92e-33 | 7u2i:2w, 7u2j:2w |
| 2 | 7u2h:1w | 73 | 73 | 1.0000 | 0.9863 | 0.9863 | 3.22e-31 | 7u2h:1y, 7u2h:2y, 7u2i:1w, 7u2i:1y, 7u2i:2y, 7u2j:1w, 7u2j:1y, 7u2j:2y |
umich.edu