gcgggaauagcucaguugguagagcacgaccuuaaggucggggucgcgaguucgagucucguuucccgcucc
The query sequence (length=72) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
| # | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
|---|---|---|---|---|---|---|---|---|
| 1 | 7f36:E | 73 | 72 | 1.0000 | 0.9863 | 1.0000 | 6.92e-33 | |
| 2 | 7f36:H | 72 | 72 | 1.0000 | 1.0000 | 1.0000 | 6.92e-33 | |
| 3 | 7f36:F | 76 | 75 | 1.0000 | 0.9474 | 0.9600 | 1.94e-28 | 7f36:G, 8qoa:Z, 7yse:E, 7zq6:M |
| 4 | 6om6:5 | 76 | 75 | 0.9861 | 0.9342 | 0.9467 | 9.01e-27 |
umich.edu